Genomic DNA extraction from sapwood of Pinus roxburghii for polymerase chain reaction studies

  • Anita R
  • Santan B
  • H S
N/ACitations
Citations of this article
11Readers
Mendeley users who have this article in their library.

Abstract

A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, where collection of needle tissues is extremely difficult has been standardized. The extracted DNA was comparable to that obtained from the needle tissue in terms of yield and purity. The yield of extracted DNA ranged from 6.98 to 19.668 µg / 100 mg tissue and A 260 / A 280 ratio ranged from 1.70 to 1.87. The polymerase chain reaction (PCR) amplification of the DNA extracted from sapwood tissue using random amplification of polymorphic DNA (RAPD), inter simple sequence repeat (ISSR) and simple sequence repeat (SSR) markers was similar to that of DNA extracted from the needle tissues.

Figures

  • Figure 1. Genomic DNA extracted from sapwood and needles of five individuals of P. roxburghii on 1% agarose gel. M: 1 kb DNA ladder.
  • Figure 2. RAPD profile of sapwood and needle samples of five genotypes of P. roxburghii generated by the primer M182. Sequence: 5’GTT CTC GTG T 3’, M: ф X 174 DNA/ Hae III Dig st.
  • Figure 3. ISSR profile of sapwood and needle samples of 5 genotypes of P. roxburghii generated by the primer UBC-809. Sequence: 5’AGAGAGAGAGAGAGAGG-3’, M: ф X 174 DNA/ Hae III Digest.
  • Table 1. Comparison of the yield and quality of DNA extracted from sapwood and needle samples of P. roxburghii.
  • Figure 4. SSR profile of sapwood and needle samples of 5 genotypes of P. roxburghii using SSR primer Pt71936. Forward: 5’ TTCATTGGAAATACACTAGCCC 3’; Reverse: 5’ AAAACCGTACATGAGATTCCC 3’. M: 100 bp DNA ladder.

Register to see more suggestions

Mendeley helps you to discover research relevant for your work.

Already have an account?

Cite

CITATION STYLE

APA

Anita, R., Santan, B., & H, S. G. (2013). Genomic DNA extraction from sapwood of Pinus roxburghii for polymerase chain reaction studies. African Journal of Biotechnology, 12(15), 1732–1735. https://doi.org/10.5897/ajb12.2733

Readers over time

‘15‘16‘17‘18‘19‘22‘2300.511.52

Readers' Seniority

Tooltip

PhD / Post grad / Masters / Doc 3

43%

Researcher 2

29%

Professor / Associate Prof. 1

14%

Lecturer / Post doc 1

14%

Readers' Discipline

Tooltip

Agricultural and Biological Sciences 6

86%

Environmental Science 1

14%

Save time finding and organizing research with Mendeley

Sign up for free
0